TE
TechEcho
Home24h TopNewestBestAskShowJobs
GitHubTwitter
Home

TechEcho

A tech news platform built with Next.js, providing global tech news and discussions.

GitHubTwitter

Home

HomeNewestBestAskShowJobs

Resources

HackerNews APIOriginal HackerNewsNext.js

© 2025 TechEcho. All rights reserved.

Translate a nucleotide (DNA/RNA) sequence to a protein sequence

15 pointsby e0mover 11 years ago

7 comments

e0mover 11 years ago
The title of the post is supposed to be: CGCATTCCGTTTCGCGAAGATAGCGCGAACGGCGAACGC<p>It got changed. <a href="http://www.wolframalpha.com/input/?i=CGCATTCCGTTTCGCGAAGATAGCGCGAACGGCGAACGC" rel="nofollow">http:&#x2F;&#x2F;www.wolframalpha.com&#x2F;input&#x2F;?i=CGCATTCCGTTTCGCGAAGATAG...</a>
kensover 11 years ago
Why is this here? Holley, Khorana, and Nirenberg got the Nobel Prize for figuring out the genetic code in 1968 so this isn&#x27;t a new result. And I don&#x27;t see anything technically interesting about the implementation of this web page. (Not trying to be snarky, just puzzled.) If this page gave the 3-D <i>structure</i> of the protein, that would be cool.<p>Edit: if you don&#x27;t understand the genetic code and DNA, you really should learn a bit about it since it will help you understand a whole lot of tech things. See <a href="http://en.wikipedia.org/wiki/Genetic_code" rel="nofollow">http:&#x2F;&#x2F;en.wikipedia.org&#x2F;wiki&#x2F;Genetic_code</a>
e0mover 11 years ago
I re-posted this at <a href="https://news.ycombinator.com/item?id=6769875" rel="nofollow">https:&#x2F;&#x2F;news.ycombinator.com&#x2F;item?id=6769875</a><p>CGCATTCCGTTTCGCGAAGATAGCGCGAACGGCGAACGC<p>It links directly to the Wolfram Alpha sequence, which more quickly illustrates what&#x27;s hidden in this sequence.
fogonthedownsover 11 years ago
These have existed for 13 years on the web or as long as I can remember. This is not very interesting.
nzukoskiover 11 years ago
If someone knows how this works, I&#x27;d love an explanation of it.
评论 #6769659 未加载
e0mover 11 years ago
It spells out RIP FRED SANGER
shaohuaover 11 years ago
WHy is this here?