The title of the post is supposed to be: CGCATTCCGTTTCGCGAAGATAGCGCGAACGGCGAACGC<p>It got changed.
<a href="http://www.wolframalpha.com/input/?i=CGCATTCCGTTTCGCGAAGATAGCGCGAACGGCGAACGC" rel="nofollow">http://www.wolframalpha.com/input/?i=CGCATTCCGTTTCGCGAAGATAG...</a>
Why is this here? Holley, Khorana, and Nirenberg got the Nobel Prize for figuring out the genetic code in 1968 so this isn't a new result. And I don't see anything technically interesting about the implementation of this web page. (Not trying to be snarky, just puzzled.) If this page gave the 3-D <i>structure</i> of the protein, that would be cool.<p>Edit: if you don't understand the genetic code and DNA, you really should learn a bit about it since it will help you understand a whole lot of tech things. See <a href="http://en.wikipedia.org/wiki/Genetic_code" rel="nofollow">http://en.wikipedia.org/wiki/Genetic_code</a>
I re-posted this at <a href="https://news.ycombinator.com/item?id=6769875" rel="nofollow">https://news.ycombinator.com/item?id=6769875</a><p>CGCATTCCGTTTCGCGAAGATAGCGCGAACGGCGAACGC<p>It links directly to the Wolfram Alpha sequence, which more quickly illustrates what's hidden in this sequence.